                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:8 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-16.79 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-22.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCGCCGAACTTGAGGCTGTCCGCGCCGCCCGCGCCGAAGCCAAGGAAAAGGCCCG
CCTCGAAGCCCTGGCTCGCCAGGAAGAGCAGATGGCCGTCAAGCGCGCCGAGCGTAAG
GAGCGCAAGGCCATCGAAGCCGCCGAGCAGCGCATGCGCAAGGAAGAGAAGGCCAAGG
AGCGTGACGAACTGCGCGCCCTGGGCAAGCCGGCCAACAGCAAGGCCTCCCGCGCCCA
CCAGTGGGCCAGCCTGCTGGGCTAAagacgacaaggggtcctttcagggcccctttttctttgcgcccGTG

    CC0372 Gene: CC0372     GI: 16124627     BI number: CC0372     GOG: COG0730     Description: conserved hypothetical protei AG C  C A  A A  A CG        CA CG       C  G GC        GC GC        GC |  T      G  T |  C      T  G |  C       GC C  C       AT CG        CG GC        CG |  G      |  G A  C      |  C A  C      |  T C  C      |  A G  A      |  A GC       |  a GC       |  g TA       |  a        t CG       |  c      t  c |  T      |  g      t  a CG       |  a       cg CG       |  c       cg G  |      |  a       tg CG       |  a       gc GC       A  g       gc C  |       Cg        gc GC        Cg        gc TA        Cg        at CG        Gt        at                         tttctttgcgcccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0730 Predicted permeases ... can be seen here     ..................................................................................................................