                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-27.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-15.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGACCAAGAACATCACGATGTCGCTCTCCGGCCAGAACCTGCTGGACAGCGAGTACTA
CGCCTACGCCAACACCACGGCCCTGCCGCGCGGCGTCTACCGCACGGGCCGCAAGCTG
CAAGCCACGCTGAACGTCGCGTTCTAAgacggtcagcggccggaggcttcggcgggatccgaagtctccggtcattgcgc
attgatcctacccctcctgactgcaagcatggagctggggcggggcggccctgccgtcccgcccgctttttgccggccgcccacgacctttcctgcgagg
ctgcGTG

    CC0447 --- CC0448 --- CC0449 Gene: CC0447     GI: 16124702     BI number: CC0447     GOG: COG3525     Description: beta-N-acetylhexosaminidase, putative Gene: CC0448     GI: 16124703     BI number: CC0448     GOG: COG1080,COG1925,COG2190     Description: PTS system, fructose-specific EIIA/HPr/EI components Gene: CC0449     GI: 16124704     BI number: CC0449     GOG: COG1263,COG1264     Description: PTS system, N-acetylglucosamine-specific IIABC componen cg g  c t  a t  t at cg ta gt gc c  |       gc c  |      a  a t  |       at c  |       cg         c t  |      g  g      c  t gc        ta        cg at        cg        gc a  a      a  c       gc g  c      g  t       cg c  c       tg        gt c  c       cg        gc t  c       cg        gc at        tg        gc gc       |  c       cg gc        cg        gc gt        cg        gc cg        cg        gc |  a       cg       g  | gc       a  c      t  | gt        tg        cg cg        cg        gc                         tttttgccggccgcccacgacctttcctgcgaggctgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3525 N-acetyl-beta-hexosaminidase ... can be seen here [G] COG1080 Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) ... can be seen here [G] COG1925 Phosphotransferase system, HPr-related proteins ... can be seen here [G] COG2190 Phosphotransferase system IIA components ... can be seen here [G] COG1263 Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific ... can be seen here [G] COG1264 Phosphotransferase system IIB components ... can be seen here     ..................................................................................................................