                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-22.10 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -7.41 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCCAAGGAAGCGCGCGCCTGGACGATCCCCGTGGGCGCCACCGGCCCGCAGGCCGC
CGGCGTGATCCACACCGACTTCGAGAAGGGCTTCATCCGCGCCGAGACGATCGCCTTC
GACGACTACGTCAAGCTGGGCGGCGAAAACGGCGCCAAAGAAGCCGGCAAGATGCGGT
CGGAAGGCAAGGAATACGTCGTCAAGGACGGCGACGTGATGCACTTCCGCTTCAACGT
CTAAgcaaccagaataccagcggccggagcagaaacgctccggccgtttttcattggggagtaagcttGTG

    CC0478 --- CC0477 --- CC0476 Gene: CC0478     GI: 16124733     BI number: CC0478     GOG: COG0412     Description: dienelactone hydrolase, putative Gene: CC0477     GI: 16124732     BI number: CC0477     GOG: COG0412     Description: dienelactone hydrolase family protein Gene: CC0476     GI: 16124731     BI number: CC0476     GOG: COG0406     Description: hypothetical protei GG         c A  A      c  a A  C      a  g CG       a  a TG       c  a GC       g  t CG       A  a TA       A  c GC       T  c CG       C  a AT        Tg TG        Gc A  A       Cg        aa A  |      |  g      g  a G  |      A  c      a  c G  |      A  c       cg A  |       Cg        gc AT        Tg        at CG        Ta        gc GC        Cg        gc |  A       Gc        cg GC       C  a       cg AT        Cg        gc AT        Ta        gc GC        Ta        cg                         tttttcattggggagtaagcttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG0412 Dienelactone hydrolase and related enzymes ... can be seen here [Q] COG0412 Dienelactone hydrolase and related enzymes ... can be seen here [G] COG0406 Fructose-2,6-bisphosphatase ... can be seen here     ..................................................................................................................