                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=28 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTCATCAAAGCCGCCGGCGCTACGGTGCCGCCCGAACCGCCGCGCGTCCTGCCGGT
CAAGGAATCGATCGCGACCAGGGGCGCGGGCTCCAACTCGCGCAAGGCCAAGACCCCC
GCCAAGAAGCCGGCCAAGAAGGGCTGAtctttcgcccattccatcacgaggggccgggcgttgcgtcgcctggccctttt
gtgtatgtagcgcgaccccaaaacgaccgggcgagcgtggcgatccagccataggcgctctggtcccagaagagagcatccggctctctagaaagaacgc
caccATG

    CC0485 Gene: CC0485     GI: 16124740     BI number: CC0485     GOG: COG1825     Description: ribosomal 5S rRNA E-loop binding protein Ctc/L25/TL            ac ct       c  g       gc t  t      t  a      t  g At       a  g      t  t Gc        cg        gc T  |       cg        cg Cg        tg        gc Gc       t  c       gc Gc       a  c       gt Gc        cg        cg |  a       cg        cg At        cg        gc At        gc        gc Gc        cg        gc                         ttttgtgtatgtagcgcgaccccaaaacgaccgggcgagcgtggcgatccagccataggcgctctggtcccagaagagagcatccggctctctagaaagaacgccaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1825 Ribosomal protein L25 (general stress protein Ctc) ... can be seen here     ..................................................................................................................