                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-16.90 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agaccgcgatgcgggcccaggcggaccgtctggcggccgagttcgacctgatccgtcgcgacgatttcgaggccctgaaggccgaggtcgcggcgctgcg
cgaggaagtggcggccttgaaggcggccaagaaggcgcccgccaagaaaaccgcgagttcaggcgaatagccgatccgccgctcgcttccagcgtgaagc
gagttgagacgaacgccgcgaagcagattagtgtccccgtacgtgagcgattcagcgcggggctaacccccgccgtcgccggcggggacgtaggtttttc
ATG

    CC0493 Gene: CC0493     GI: 16124748     BI number: CC0493     GOG: COG5465     Description: hypothetical protei tt a  c g  a cg gc a  | g  |       ta t  |      c  a g  |       gc        cg c  |       gc       t  c a  |       gc        gc tg        gc        cg gc       c  |       cg cg        gc        gc cg        cg        cg cg        gc        cg cg       a  c       cg t  |      c  |       cg g  |      t  |      |  a t  |       tg       c  c gc        at       a  g at        gc        at ta        cg        ta ta        gc        cg                         gtttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5465 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................