                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-22.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTCATCGTGGGTCGTCTGATCCCCGCCGGTACGGGTTCCTACCTGCGCAGCCTGCAA
CGCGTCGCCGCCAAGCGCGACGAACAGCTGGCCCAGCAGCGCGAAGATGCGATGGAGC
CGCTGCCGGCCGAGATCGCGCTTTCGGACGCCGAATAGgcgcccgaaacagtcgaagacccggacgccaaaa
gtgtccggggcgacgccgagcaaggttttcgccaattgattgaggaaaggcccgggagagatcccgggcctttcttttgggttgagtagatcgcccacag
attgggtaaccgGTG

    CC0504 Gene: CC0504     GI: 16124759     BI number: CC0504     GOG: COG0840     Description: methyl-accepting chemotaxis protein Mcp            tg           t  a            at            at            cg           c  a           g  |            cg            tg            ta        ag gc        ta       g  a a  a       ta        at g  a      g  g       gc cg       g  |       gc cg       a  |       gc gt       a  |       cg |  t       cg        cg c  t       gc        cg at       a  c       gc gc        gc        gc cg        cg        at gc        cg        at                         tcttttgggttgagtagatcgcccacagattgggtaaccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................