                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-33.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGAGGGCCACAAGCCTTCGGCATCGCTGAAGGACGGGGCCCTGACCATCACCTACT
CTCCGGAACAGGGTTTGGCGGGGCGCCCCTCCTCGAAACGGATCATCAAGGTGATCAA
TCGCTAGagccctttagctttagatggaatcatctaaagcgtttgaaagggctctaagtgtttgattttagagcctttttatctggtttagatgg
ttccatctaaaccagacaggctctaggcgcgattggcgaacgccgttctttgagtgtaaccataaagactcagcagcggtttactgggcTTG

    CC0513 --- CC0514 --- CC0515 --- CC0516 Gene: CC0513     GI: 16124768     BI number: CC0513     GOG: COG1609     Description: hypothetical protein Gene: CC0514     GI: 16124769     BI number: CC0514     GOG: COG2801     Description: IS511, transposase OrfA Gene: CC0515     GI: 16124770     BI number: CC0515     GOG: COG2801     Description: IS511, transposase OrfB Gene: CC0516     GI: 16124771     BI number: CC0516     GOG: COG1609     Description: transcriptional regulator, LacI famil aa g  t gc ta at gc at ta ta ta cg gc |  g |  t |  t |  t a  g ta ta        tt ta       t  g cg       g  a cg       t  t cg        gt gc        at at        at Gc        ta At        cg |  a       ta Ta        cg Cg        gc Gt        gc Cg        gt             ttttatctggtttagatggttccatctaaaccagacaggctctaggcgcgattggcgaacgccgttctttgagtgtaaccataaagactcagcagcggtttactgggcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1609 Transcriptional regulators ... can be seen here [L] COG2801 Transposase and inactivated derivatives ... can be seen here [L] COG2801 Transposase and inactivated derivatives ... can be seen here [K] COG1609 Transcriptional regulators ... can be seen here     ..................................................................................................................