                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-22.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGGACTTGGCCGCCTCCTACAATGTCTCGGACCGGTTCAGCCTGGGCCTCGATGTT
TACAATCTGACCGACGCGATCCGCTTCGAGTACGAAAACGACGAGGATGTGGTGCGGA
CGGCCAATTACGACGGACGTACGATCACCCTCACCGCGCGCGCTGCGTTCTGAtcttcacc
cctcctgtgaagtttgacggccggtctatccggatcggccgtcgcctttttcatagaggagggcgatttctatagaggagggcggtcggcgcgcgccgag
gccctcggatcgtcggaggcttcATG

    CC0572 Gene: CC0572     GI: 16124826     BI number: CC0572     GOG: COG5434     Description: conserved hypothetical protei             t           c  c           c  c   C       c  t C  T       cg C  C       at A  A       cg C  C       ta T  C       ta A  G       cg        tc GC       t  |      a  c CG        At        tg A  C       Gt        cg T  G      T  t       ta GC       C  |       gt CG        Tg        gc A  |       Ta        cg GC        Gc        cg GT        Cg        gc CG       |  g       gc A  |      |  c       cg GC        Gc        at CG        Tg        gc AT        Cg        tg                         cctttttcatagaggagggcgatttctatagaggagggcggtcggcgcgcgccgaggccctcggatcgtcggaggcttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5434 Endopolygalacturonase ... can be seen here     ..................................................................................................................