                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:92 nt.    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-22.20 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=50 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:    Distance from promoter:48 nt.    Size=26 nt.     Delta G=-14.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtcg-tcaact. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcgtcgccgcaactctctcgtcaactctctgtgacacggggaacaacgacgtttcccgttggctcgaaagagccgccggcggcgctgtaggccgtca
ggcaagcttggacaacgacgtccggagggaccgctgcgcgcggtctcgccgggcgtttttttgttTTG

    CC0608 --- CC0609 --- CC0610 --- CC0611 --- CC0612 Gene: CC0608     GI: 16124862     BI number: CC0608     GOG: NOG39724     Description: hypothetical protein Gene: CC0609     GI: 16124863     BI number: CC0609     GOG: COG0715     Description: nitrate ABC transporter, periplasmic nitrate-binding protein Gene: CC0610     GI: 16124864     BI number: CC0610     GOG: COG0600     Description: nitrate ABC transporter, permease protein Gene: CC0611     GI: 16124865     BI number: CC0611     GOG: COG1116     Description: nitrate ABC transporter, ATP-binding protein Gene: CC0612     GI: 16124866     BI number: CC0612     GOG: COG3707     Description: response regulator Nas            cg           a  a           a  c            cg            at            gc            gc           t  |            tg            cg           g  a           a  g           a  g        c           c  |      g  g   g       g  |      t  c t  t      g  |       cg c  a      a  |       gc g  g       cg        cg cg        ta        cg gc        gc        at gc       c  c       gc cg        cg        gt gt        gc        gc gc       g  |      a  g |  a       at        gc cg        tg        gc cg        gc        cg gc        tg        cg                         gcgtttttttgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [T] COG3707 Response regulator with putative antiterminator output domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_crescentus                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:90 nt.    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-26.20 kcal/mol Antiterminator:    Distance from promoter:59 nt. Size=50 nt.     Delta G=-11.70 kcal/mol Anti-antiterminator:    Distance from promoter:28 nt.    Size=26 nt.     Delta G=-14.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtcg-tcaact. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtcgtcgccgcaactctctcgtcaactctctgtgacacggggaacaacgacgtttcccgttggctcgaaagagccgccggcggcgctgtaggccgtca ggcaagcttggacaacgacgtccggagggaccgctgcgcgcggtctcgccgggcgtttttttgttTTG     CC0608 --- CC0609 --- CC0610 --- CC0611 --- CC0612 Gene: CC0608     GI: 16124862     BI number: CC0608     GOG: NOG39724     Description: hypothetical protein Gene: CC0609     GI: 16124863     BI number: CC0609     GOG: COG0715     Description: nitrate ABC transporter, periplasmic nitrate-binding protein Gene: CC0610     GI: 16124864     BI number: CC0610     GOG: COG0600     Description: nitrate ABC transporter, permease protein Gene: CC0611     GI: 16124865     BI number: CC0611     GOG: COG1116     Description: nitrate ABC transporter, ATP-binding protein Gene: CC0612     GI: 16124866     BI number: CC0612     GOG: COG3707     Description: response regulator Nas            cg           a  a           a  c            cg            at            gc            gc           t  |            tg            cg           g  a        c           a  g      g  g           a  g      t  c           c  |       cg   a       g  |       gc g  a      g  |       cg c  a      a  |       cg t  g       cg        at ca        ta        gc gg        gc        gt gc       c  c       gc tc        cg       a  g tg        gc        gc gc       g  |       gc |  c       at        cg cg        tg        cg cg        gc        tg cc        tg        gc                         gtttttttgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here [T] COG3707 Response regulator with putative antiterminator output domain ... can be seen here     ..................................................................................................................