                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.47 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGATGACGTCTCCGGCCTGTTCGGTCAGGAGGCGGAAGAAGGCCTCGCTGGCCCTCA
AGGCGTCGATGTCTTGTGGAAACGGCGTCGGCATtacgtgttcatcgccccggaagcctgaacaacatcgttata
ttctagggatgcgacaatgggtcgcgtcagcgatggttcaggtgggctcgacggcctcttctttactcaacctctacatgtccaggcactcgccctgcga
gtttgtttgctccgtcccgtcgaagcgggctagctgaatacaggcgcaggcacgagggcgacgcatcATG

    CC0651 --- CC0650 Gene: CC0651     GI: 16124904     BI number: CC0651     GOG: NOG40850     Description: conserved hypothetical protein Gene: CC0650     GI: 16124903     BI number: CC0650     GOG: -------     Description: hypothetical protei            ac           a  c           c  t           t  c           c  t           a  a           t  c           t  a           t  t           c  g           t  t ga       t  c c  c      c  c tg        ta cg        cg         c gc        cg       c  t gc        gc        cg gt       g  a       gc t  |      c  c       cg gc        at        ta gt        gc        cg at        cg        at                         ttgtttgctccgtcccgtcgaagcgggctagctgaatacaggcgcaggcacgagggcgacgcatcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_crescentus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:104 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-10.90 kcal/mol Antiterminator: Size=34 nt.     Delta G=-12.30 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G=-11.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGATGACGTCTCCGGCCTGTTCGGTCAGGAGGCGGAAGAAGGCCTCGCTGGCCCTCA AGGCGTCGATGTCTTGTGGAAACGGCGTCGGCATtacgtgttcatcgccccggaagcctgaacaacatcgttata ttctagggatgcgacaatgggtcgcgtcagcgatggttcaggtgggctcgacggcctcttctttactcaacctctacatgtccaggcactcgccctgcga gtttgtttgctccgtcccgtcgaagcgggctagctgaatacaggcgcaggcacgagggcgacgcatcATG     CC0651 --- CC0650 Gene: CC0651     GI: 16124904     BI number: CC0651     GOG: NOG40850     Description: conserved hypothetical protein Gene: CC0650     GI: 16124903     BI number: CC0650     GOG: -------     Description: hypothetical protei ca a  t                 gg a  c                a  t cg                  cg at                  tg at                  tg g  a        t        gc t  t      a  g       gt c  a      a  g      t  | c  |       cg       a  | g  |       at       g  | at        gc       c  | at        cg       g  | gc        gc       a  | gt        tg       c  | |  a       at       t  | cg        gc        gc cg       |  a       cg cg       |  g      |  a |  a      |  c       gc |  t      g  g       cg cg       g  a       tg gc        at        gc cg        tg        gc ta        cg        gt                         cttctttactcaacctctacatgtccaggcactcgccctgcgagtttgtttgctccgtcccgtcgaagcgggctagctgaatacaggcgcaggcacgagggcgacgcatcATG     ..................................................................................................................