                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggggaggattTCATTTCGGTCCCGTCGCAGCCTTGAACACCGTGCCGCCGAGCAGCAGCACC
AGCACGAAGCCGACCAGGAACAGGAAGAACAGGATCTTGGCGACGCCGGCCGCCGCAC
CGGCCAGGCCGCTGAAGCCCAGAGCGCCGGCGATCAGGGCGACGATGGCGAGGATGAT
GGCCCATTTGAGCATgtcgaattccctccagaagcgcgccgggggcgcgattgcaaaatcaacgtcgctgcgacgcgcggcgttccttg
ttttccccgcccggcgcctttaactcgaacgccATG

    CC0672 --- CC0671 Gene: CC0672     GI: 16124925     BI number: CC0672     GOG: COG4547     Description: cobalamin biosynthesis protein Gene: CC0671     GI: 16124924     BI number: CC0671     GOG: COG4246     Description: hypothetical protei            ca           g  a            ta            ta            at            gc           |  a           c  a            gc            cg         a            gt       g  c            gc        cg           g  g       gc            gc       t  |   g        gt        cg g  g      c  |       gc cg        cg        cg cg        gc        tg gc        cg        gc cg       |  a       cg gc        gc        at cg        cg        at                         ccttgttttccccgcccggcgcctttaactcgaacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4547 Cobalamin biosynthesis protein CobT (nicotinate-mononucleotide:5, 6-dimethylbenzimidazole phosphoribosyltransferase) ... can be seen here [S] COG4246 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................