                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-24.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-17.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGTACACCAACAGCCGTTCGGGCGGCGTGGTGGTCAACGCCCAGTGCGCCCGCGCC
GACGGCACGGCCGCCGGTTCGGCGGACCCGACCTGCGCGGCCTATCGCTACAGCTACA
CCACGGCCTCGCCGGCCACCCTGGCCACCCCGACGGTCGACCAGGCCGCCAGCCTGTG
GTCGGTGGGCATGGGCCTGAAGTACCGCTTCTAGGGCCAAGCTTTCCAAGAGAATGAC
GAAGGGCGCGGCTTCGGCCGCGCCCTTTTTCATggtcgatccgccggacggaatgctacgcctcggccATG

    CC0738 Gene: CC0738     GI: 16124991     BI number: CC0738     GOG: COG0436     Description: aminotransferase, class             C           C  A           T  A            TG   C        TA A  C       CG T  G      G  A GC       A  A AT        AT AT        CG GC       C  A |  T      G  C TA       G  G       TC CG       G  A      T  G CG       A  A       CG G  G       TG        GC GC        CG        GC GC        TG        CG TA       T  C       GC A  A       CG        CG CG        GC        GC GC        CG        GC GT        CG        GC                         TTTTTCATggtcgatccgccggacggaatgctacgcctcggccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0436 Aspartate/tyrosine/aromatic aminotransferase ... can be seen here     ..................................................................................................................