                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.70 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-20.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGACGCCAACAAGGCCGCCGCCGACGCCGCCGCCGCGCCGGTCGATCCGGCCGAC
GCCGCCGCCGCCGGCGCCACCTCGACGACCGCCCCCGCCGAAGCGGCCGCGCCGGCCG
AGGCCGCCAAGCCGGAAGAGAAGAGGCCGCGCATTAGGGCTCGAAAAACCTCGCCCTT
CGACAAGCTCAGGGTGAGGTTTTCGACTGCCGGCTCACAATAGTCCTCACCCTGAGCC
TGTCGAAGGGCGAGGACGGGCTCACCAGCCTCTCTCAAagggccgttccctggaacggtcctttttcgTT
G

    CC0748 Gene: CC0748     GI: 16125001     BI number: CC0748     GOG: COG0665,COG4121     Description: conserved hypothetical protei   T C  G C  T G  C       AC A  G      C  C G  A       TA TA        CG CG        GC CG        GC CG        GT A  C      C  C CG       A  | TA        GT CG        GC CG        AT TA        GC GC       |  A A  |      |  A       ct T  |      |  a      c  g A  |      |  g       cg A  |      |  g       ta C  |       Cg        ta A  |       Gc        gc CG        Gc        cg TG       G  g       cg CG        At        gt GC        At        gc GT        Gc        gc                         tttttcgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [S] COG4121 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................