                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACATAGTCGGCGGCCTCGCCCTCGCCGAAGATCTCTTCGTCGCGGTGGAAGCGGGCGC
AGGCTCCCGGGGCGGGCAGGACGGCGTCGAGCGAGTAGTCGTTTTCGAACGTCTTGGC
GCGGATCGGAGACAGCATgggaaaccccctcatttgttgtgggttttttgcgccatctcaaacgggttcgaaattcggggcatgcgc
ctaaggagcggtccgctaaggggagtcccttaggcggcgatgctgagggcggcgattttgacgccgatcaaggcgcgccgcctgcccttgtggcggcTT
G

    CC0753 Gene: CC0753     GI: 16125006     BI number: CC0753     GOG: COG0784     Description: conserved hypothetical protei TA G  G AT GC        TG CG       T  G GT       C  C        a |  T       TG       a  c |  T       GC       a  c AT        CG        gc GC       |  G       gc CG       A  A       gc TA        AT       |  t G  A       GC       |  c C  |       CG       |  a G  |       TG       |  t GC        TA       T  t CG        TG        At AT        TA        Cg GC        GC        Gt GT       C  A       At AT        TG        Cg CG        GC        At                         gggttttttgcgccatctcaaacgggttcgaaattcggggcatgcgcctaaggagcggtccgctaaggggagtcccttaggcggcgatgctgagggcggcgattttgacgccgatcaaggcgcgccgcctgcccttgtggcggcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0784 FOG: CheY-like receiver ... can be seen here     ..................................................................................................................