                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcttttatccaccgcgcctcactcgcgagccacccggcccgcgttcaacgtttattattcggagccacgtcGTGAAGCGCACCTTCC
AGCCGTCGAAGCTCGTGCGTGCCCGCCGTCACGGCTACCGCGCGCGTATGGCCACCAA
GAACGGCCAAAAGGTCGTCGCGCGTCGCCGCGCCAAGGGCCGCAAGCGCCTGACCGCC
TAAttctctttcctccttcgggaggtaagacgatgatcaaagccgccttttccacagacctgtcttcaggttctcgccggaaaggcggcttttttcA
TG

    CC0768 --- CC0767 Gene: CC0768     GI: 16125021     BI number: CC0768     GOG: COG0594     Description: ribonuclease P protein component Gene: CC0767     GI: 16125020     BI number: CC0767     GOG: COG0706     Description: 60 kd inner-membrane protei ct t  t gc ta cg cg |  t at gc at |  c        a |  g      g  a c  c      g  a a  c       cg cg        cg cg        gc ta        cg ta        tg             cttttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0594 RNase P protein component ... can be seen here [U] COG0706 Preprotein translocase subunit YidC ... can be seen here     ..................................................................................................................