                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-24.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCCTTTTTCTGGTGCTGCTGGGCATCGCGCTGAAATCGGATCGCTGGTGGCCGATG
TGGGCCTGCGCGTTCCACGCACTTTCGATCGTGCTGGCCCTGGCCATGCTGGCCGACC
CCAGGGTCTGGAGCCGCTCGGGCTTCATCGCCAGCGGCGTGTTCAGCTATCTGACCAT
GCTGTCCCTGTTCCTCGGCGCGCTGGGTCAGAAGCCCGGCGGCAAGCCGCCAGCGCCT
GACGCCGCGTCACGGCTGACATAGccgctggcgcctgtttttctcccgccaaccaagaggaggaactgATG

    CC0779 --- CC0778 Gene: CC0779     GI: 16125032     BI number: CC0779     GOG: COG0183     Description: thiolase family protein Gene: CC0778     GI: 16125031     BI number: CC0778     GOG: COG0625     Description: glutathione S-transferase family protei AA C  G GC GC CG GC GC C  A C  | CG GC A  G A  C                  C GC                 A  A AT                  GT CG                  TA TA         C        CG GC       C  G       Gc G  |       GC        Gc G  |       CG        Cg T  |       AT       |  c CG        GC        At GC        TA        Cg C  |      |  C       Tg GC        CG        Gc CG        CG        Cg GC        GC        Gc                         ctgtttttctcccgccaaccaagaggaggaactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0183 Acetyl-CoA acetyltransferase ... can be seen here [O] COG0625 Glutathione S-transferase ... can be seen here     ..................................................................................................................