                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=58 nt.     Delta G=-25.10 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-27.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcgtctgctgacaacgctatcaaatccgcttgctggtctgaattatatgattatagtttcggtcactgccggatcggggccatttaccggttcggtggcg
cgaggagggcctcaccggccttcgagcgcttcgcgcggcgcctctccccgaggtcgcgcgacgtcctcccccgcgcatcgtcacctgcgacggtgcgcgg
atttttttgaccggtgagcaaacccggacttgccgtcgctccagagcccggcgatcgtccatcaatagctggtagcgctaccaagtagagcgcaccacga
GTG

    CC0788 --- CC0789 Gene: CC0788     GI: 16125041     BI number: CC0788     GOG: COG1874     Description: hypothetical protein Gene: CC0789     GI: 16125042     BI number: CC0789     GOG: COG1501     Description: glycosyl hydrolase, family 3             c           c  c   a       t  c c  c       cg t  c       ta cg        cg cg        cg gc        gt gc       c  | gt       g  | at        gc gc        cg |  g       gc |  a       cg |  g       gc |  c       cg |  g       ta |  c      |  c gt       |  g at       |  t gc       |  c cg       |  c       ct gc       |  t      c  g cg       |  c      a  c gc       |  c       cg |  g      |  c       ta |  g      |  c       gc gc       t  c       cg tg        cg        tg gc        gc        at gc        cg        cg c  t       gc        gc t  c      |  a       cg t  t       at        gc gc        gc        cg gc        cg        cg                         atttttttgaccggtgagcaaacccggacttgccgtcgctccagagcccggcgatcgtccatcaatagctggtagcgctaccaagtagagcgcaccacgaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1874 Beta-galactosidase ... can be seen here [G] COG1501 Alpha-glucosidases, family 31 of glycosyl hydrolases ... can be seen here     ..................................................................................................................