                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-25.20 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-29.19 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCTGGCCGCGGCCAGCCTGCCGATGACCTACGGCTTCTATGCGCTGAGCGCTGTCG
TCTCGTTCTTCCTGGTCCAGAAGCTGGTCCACGAAACGCGCGGCAAGGAACTGGAAGC
GATGCAGGGGTGAtgaagccaatcctccccctcgcgggggaggatttgggaaaagccaaacgcccgggagccctcgcttccgggcgttttc
ttttgcgccccgcagccatgacaccggtagacaaaacgcatgttaccgctagcttggcggcaacaagacaagtctgcgtaagggaggaccaccATG

    CC0813 Gene: CC0813     GI: 16125066     BI number: CC0813     GOG: COG3507     Description: hypothetical protei            cg           t  c            cg            cg            cg            cg            cg            ta            cg            cg            ta            at           |  t           |  t           a  g            cg            cg           |  a           |  a           g  a           a  a           a  g           g  c cc       t  c g  a      A  a       ct a  a      G  a      c  c at        Ta        cg gc        Gc        gc t  c      |  g       at At        Gc        gt Gc        Gc        gc T  |       Gc        gc Gc       A  g       cg Gc       C  g       cg Gc       G  g       cg Gc       T  a       gc At       A  |       cg |  c      G  |       at Cg        Cg        at Gc        Gc        at                         tcttttgcgccccgcagccatgacaccggtagacaaaacgcatgttaccgctagcttggcggcaacaagacaagtctgcgtaagggaggaccaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3507 Beta-xylosidase ... can be seen here     ..................................................................................................................