Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-13.99 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCTGGTCGACGAGGCGACGATCGCCGCGCGCAAGCAGGACGGCATCCCGGCGGTTC
CCGCCACCATGACGCCCTGGCAGGAAATCTACCGCGCCCACGCCAGTCAGCTCGACAC
CGGCGGCGTGCTGGAGTTCGCGGTCAAGTACCAGGACCTGGCGGCCAAGCTGCCCCGC
CACAACCACTGAtgcgaagggccttcggagcgatccggaggcccttttctttgcgccccccggatcgcccgcccccgcttcacaacaccca
gccgaatcgcattttctccgtcgccaaacgctgaaATG

    CC0818


Gene: CC0818     GI: 16125071     BI number: CC0818     GOG: -------     Description: hypothetical protei


  A
C  A
 CG
 GC
 GT
 CG
 GC
 GC
T  |        C
C  |      C  A
C  |      A  C
A  |       AT
G  |       CG
G  |      A  A
A  |      C  t
C  |       Cg
C  |       Gc
A  |       Cg
T  |      |  a
G  |      |  a
A  |       Cg
A  |       Cg        cg
C  |       Cg       g  a
T  |       Gc        at
 GC       T  |       gc
 GC       C  |       gc
 CG        Gc        cg
 GC        At        tg
C  C       At        ta
T  A      |  c       cg
T  C       Cg        cg
G  A       Cg        gc
A  A      |  a       gc
 GC       G  g       gc
 GC        Gc        at
 TA        Cg        at
                        ttctttgcgccccccggatcgcccgcccccgcttcacaacacccagccgaatcgcattttctccgtcgccaaacgctgaaATG


    ..................................................................................................................