                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-23.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.92 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccctgtccccaccgcgttcagccccgcaggcctacaacaccgatcaacggctttcgtagtcgttccaaagccgccggcgtcttgatccctccgccagcgc
gccagactgcgccgtccggttcccctccgggcggcgctttttcgtgagcgcgcacctaatcatcgttcggttgacgaccgcgactggtccccgggcgaaa
tctgctgtagccccaacctggaggtaagagccgtcttaacccttggcgtccgacgctgggttaggaagtctcttagggatagggagcgcgtacaggcgtc
ATG

    CC0849 Gene: CC0849     GI: 16125102     BI number: CC0849     GOG: COG3605     Description: phosphoenolpyruvate-protein phosphotransferas            ag           c  a           c  c            gt            cg            gc            cg            gc           a  |           c  |           c  |           g  |           c  |           c  |           t  | at       c  | g  c      c  | t  c      c  |        c t  c      t  |      c  c c  t      a  |      t  c t  c      g  |      t  t gc       t  |       gc cg       t  |       gc gc       c  |       cg gc       t  |       cg c  a       gc        tg cg        cg        gc gc       |  t       cg cg        gc        cg |  c       gc        gc cg        cg        cg gc        cg        gc                         tttttcgtgagcgcgcacctaatcatcgttcggttgacgaccgcgactggtccccgggcgaaatctgctgtagccccaacctggaggtaagagccgtcttaacccttggcgtccgacgctgggttaggaagtctcttagggatagggagcgcgtacaggcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG3605 Signal transduction protein containing GAF and PtsI domains ... can be seen here     ..................................................................................................................