                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-18.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-14.43 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAAAGACCATCGGCGCGTCCGCTTTCCGCTAGGACCGCTGGCTGTACGGCGATTAT
CCGCCGCGCCCCTTGAATGGGGCGGAAGGCGCACCATTTGTTAGCCGTAAGCAATCGC
CCGCTTATGCCTTCGCGCCTCCCAAGGCCCGAACGTTCAGGGCGATGCTTCATtcgctacg
caccgtcagaggcggtcttgagcgatttcccacccatctagcgtttggggccggcgatgtcgcaggcccctgttttggaacttcatgaaaaccgtttcta
tccgcgaggccgccgctcggcgcATG

    CC0854 Gene: CC0854     GI: 16125107     BI number: CC0854     GOG: -------     Description: hypothetical protei cg a  c t  a c  c gc cg t  t T  c A  a Cg Ta         c Tg       a  c Cg       c  c Gc       c  a Tg       c  t A  |      t  c G  |      t  t Cg       t  a Gt       a  g Gc        gc        tg Gt        cg       a  t At        gt        gc Cg        at        cg Ta       g  t       gc Tg       t  g      g  a Gc        tg        cg Cg        cg        cg |  a       tg        gc At        gc        gc At        gc        gc Gt        cg        gc                         tgttttggaacttcatgaaaaccgtttctatccgcgaggccgccgctcggcgcATG     ..................................................................................................................