                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCCGGCCGCCGAAGCGGCTCCGGCCTCGGACGACGGCGAAGAGGTCAAGAAGCCC
CGCCGCCGCCGCGCCCCGCGCAGCTTCGAGGCCGCCGAAGGCGCGCCGGCCGAAGGCG
GCTCGGACGAAGGCTGAtccgtccggacatcatgcgaaatgcgaaagggagccgtgaaagcggctccctttttcgttggcaggcgggg
cttgatagggtcccacggtcagcttgactggttgccctcgccgcgccggccgaggataagacttgtgtcgacttcgaaacacagttcgccgagcccATG

    CC0877 Gene: CC0877     GI: 16125130     BI number: CC0877     GOG: COG0501     Description: conserved hypothetical protei            tg           a  c            cg            ta           a  a           c  a           a  t           g  g            gc            cg CT       c  a G  G      t  a       aa G  A      g  a      g  a A  t       cg        tg A  c       cg        gc Gc        tg        cg Cg       A  |       cg At       G  |       gc Gc        Ta        at Gc        Cg        gc Cg        Gc        gc Tg        Gc        gc                         tttttcgttggcaggcggggcttgatagggtcccacggtcagcttgactggttgccctcgccgcgccggccgaggataagacttgtgtcgacttcgaaacacagttcgccgagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0501 Zn-dependent protease with chaperone function ... can be seen here     ..................................................................................................................