                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAGGGTCTTGCGGCCGTAGTGGGCCAGGATCATCCAGACGAAGGCCGCCTGGCCGA
TCGCGGCCACGCAGAACCAGGCCATAGCCGCGCGCCGCAGCATCCGCTCGGCGGCCAG
CCGCGCCGCCCCCTCGCCCAGGGGGCTCGCATGGGGATCATTCATCGTCATCACgcgcct
gtcgctcctgtgtcggctcgtcctggtctcggcgcgtggaccggaaacggcggagggtctcgccgatttggaaatcggctatggattgtttccggaggcg
tgagcgccacgatccagggagccgTTG

    CC0891 Gene: CC0891     GI: 16125144     BI number: CC0891     GOG: COG2207     Description: transcriptional regulator, AraC famil                      gg                     t  a                      ta                      ta                      at                      gc            gg        cg           g  t       cg           a  c       gc            gt       |  t aa        gc       |  a g  a       cg       c  t gc        gc        tg cg        gc        cg cg        cg        ta                         ttgtttccggaggcgtgagcgccacgatccagggagccgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2207 AraC-type DNA-binding domain-containing proteins ... can be seen here     ..................................................................................................................