                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCCCCAGGGCGGGGTCGGCGCGGCCGCTTAAgaccagggcgtcgaggtggcgggaccgaaaacctcgcccttcg
acaagctcagggtgaggttttctatgcctggcccggcgcttcattcgtcctcaccctgagcctgtcgaagggcgaggacgacgcaaagctccgggccgat
ctggccgccgccgcgaccatcggtccggcgccgcgccgcgaaaaatttggttaacaagatggcggcgggccgcaaatcgctccaagcgaaagcctagctt
cccatccccggttcaaggttccgaATG

    CC0910 --- CC0911 Gene: CC0910     GI: 16125162     BI number: CC0910     GOG: COG1298     Description: flagellar biosynthesis protein FlhA Gene: CC0911     GI: 16125163     BI number: CC0911     GOG: COG3746     Description: hypothetical protei gg a  g c  c cg at gc A  g        a A  a      g  a T  |      c  a T  |      c  a        a C  |      a  c      a  g G  |       gc       c  c Cg        gt        at Cg        gc        gc Gt        cg       c  | G  g       gc       t  | Cg        gc        ta Gc       t  |       cg Cg        gc        cg G  g       gt        cg G  |       at        gt Cg        gc        cg Ta        cg        ta Gc        ta        cg Gc        gc        cg                         ttttctatgcctggcccggcgcttcattcgtcctcaccctgagcctgtcgaagggcgaggacgacgcaaagctccgggccgatctggccgccgccgcgaccatcggtccggcgccgcgccgcgaaaaatttggttaacaagatggcggcgggccgcaaatcgctccaagcgaaagcctagcttcccatccccggttcaaggttccgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG1298 Flagellar biosynthesis pathway, component FlhA ... can be seen here [P] COG3746 Phosphate-selective porin ... can be seen here     ..................................................................................................................