                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-28.50 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcggcgtcggttcggcctcgcagctggcgaggacgaactgggccagcatgatacacaggatggcgaaggccgcgcgctggagccgttttgatacaaaaat
cgccgcgtccgccgccatggccggttctccctcgggtactggagaaccccagcgcaagaccggcgccgtccgagagcgtgatagccgaaagtgtgagcgg
tttcggcggccatcacgctctaagtgtttgatttagagccctttttgtccgatctgattggttcaatcagatcggaaagggctctagcaggagcgatccg
ATG

    CC0923 Gene: CC0923     GI: 16125175     BI number: CC0923     GOG: COG0491     Description: metallo-beta-lactamase family protei            ga           t  g            gc ga        tg a  g      g  g gc        at cg        at |  t       at cg        gc ta        cg gt        cg c  a       gc c  |      |  g g  |      |  g cg       |  c        t gc       a  c      t  t gc        ta       g  g cg        at        ta c  a       gc        gt a  a       ta        at g  a       gc        at a  g       cg        ta at        gc        cg cg        at        ta gt        gc        cg cg        at        gc                         cctttttgtccgatctgattggttcaatcagatcggaaagggctctagcaggagcgatccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................