Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.76 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGCACGGCTGGTCGATCGCGGCCGGCCAGTACGACATCGCCCTGGGCGCTTCGTCC
CGGGCCATCTCCTCCACCGCCCAGGTCACACTGGCGGCTCGGAGCCTGCCGGTTTCCC
CGGCGGCGAAGTAGtgagcgtccggtaggcggctgcacgcctcccgccgttccctgcgtctcttcccctctcaaggagcgtcgccatccg
cgacgctccctttttttgcccgtcggtttgcctcgcgccattgatcgcataattagggccaccgccctgtcgcggcgaaggggagacaagcagcGTG

    CC0967


Gene: CC0967     GI: 16125219     BI number: CC0967     GOG: COG0673     Description: oxidoreductase, Gfo/Idh/MocA famil



  t
t  c
c  c
t  c
c  c
t  t
g  c
c  t        t
 gc       a  c
 ta       c  c
c  a       cg
 cg        gc
 cg        cg
 ta        ta
 tg        gc
 gc        cg
 cg        gc
c  t       at
 gc        gc
 cg        gc
            ctttttttgcccgtcggtttgcctcgcgccattgatcgcataattagggccaccgccctgtcgcggcgaaggggagacaagcagcGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here

    ..................................................................................................................