Gene putatively regulated by attenuation in C_crescentus
Characteristics of the secondary structures
Terminator: Distance to gene:82 nt. Distance to run of Ts=1 nt. Size=27 nt. Delta G=-22.80 kcal/mol
Antiterminator: Size=42 nt. Delta G=-12.65 kcal/mol
Anti-antiterminator: Size=23 nt. Delta G=-14.70 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
AGGGTAAGACCCAGTACGCCAATCAGAACGAGTTCGAGCCCCGCTACACGCTGGGTAT
CCGGGCTCGCTGGTAGgcgagagcctgtccgcttctgatggaaacatcagaagcggatcaacaggcgcgatctcgagcatttttgagc
gtggcggccacgctcaagtccccctctcacctcctgcggccgctgtggaacccccacggcggccaattttttagggagacggcgcctgtccggtttgggc
ggcagccgctagcctgaaggcaaaccggacacagagccggaaccgggagcgaccATG
CC0971 --- CC0972
Gene: CC0971 GI: 16125223 BI number: CC0971 GOG: NOG10077 Description: tryptophan halogenase, putative
Gene: CC0972 GI: 16125224 BI number: CC0972 GOG: NOG10077 Description: tryptophan halogenase, putativ
ct
c c
c t
c c
c a
t c
g c
a t
a c c
c c a c
g t t a c
c g cg gc
gc gc gc
gc c | ta
ta a | gc
gc cg tg
cg cg cg
gc gc gc
at gc cg
gc cg cg
ta gc gc
ta gt gc
aattttttagggagacggcgcctgtccggtttgggcggcagccgctagcctgaaggcaaaccggacacagagccggaaccgggagcgaccATG
..................................................................................................................