                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-22.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGAACCCGGTCTACACTGCGCCGTTCGGCCAGTTGGACATCAACGTCAGCTACGAC
GTGACGCCGAAGCTGGCGATCTCGCTGGAAGGCATCAACCTGACCAAGGAAAGCCTGC
GGACCTACGCTCGCGACGAGAACCAGCTGTGGTTCGCCCAAGAGCTGGATCGTCGGAT
CCTGCTCGGCGCGCGCTACCGCTTCTAGtcgcaagaccggaagcaaggatggggtcgccgcttgcggcggcccctttct
tcctttgaagtaggcgtatcgagggtgggtcggcgtccatgaaccgaGTG

    CC0998 --- CC0999 --- CC1000 Gene: CC1000     GI: 16125252     BI number: CC1000     GOG: NOG05503     Description: hypothetical protein Gene: CC1001     GI: 16125253     BI number: CC1001     GOG: KOG2132     Description: Pass1-related protein Gene: CC1002     GI: 16125254     BI number: CC1002     GOG: NOG10330     Description: tryptophan halogenase, putativ ca g  a cg ta Gc A  c T  g Cg Ta Ta Cg Gc |  a |  a |  g       tt |  g      c  g |  a       gc |  t       cg |  g       cg |  g       gc Cg        cg Cg        tg At        gc T  c       gc Cg        gc Gc        gc             tttcttcctttgaagtaggcgtatcgagggtgggtcggcgtccatgaaccgaGTG     ..................................................................................................................