                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-16.25 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-20.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCTGGTGAAAGCCGCCGCCGGCGCCGACAAGGCGCTGATCACCGCCGCCCGCGTGT
TCGACGTCTATGAAGGCCCCGGCGTGCCCGACGGCTTCAAGTCGGTCGCCATCGAGGT
CGTGGTCCAGCCGCGCGAAGCCACCCTGACCGACGCCGAGATCGAGGCCCTGTCGGCC
AAGGTCGTCGCGGCGGCGGAGAAGGCCGGCGGTAAGCTGCGCTCATAAcgcccttctccccttg
cgggagaaggtggcggccgtcaggccgacggatgaggggtcgcgcaggcggcccctttttcgTTG

    CC1042 Gene: CC1042     GI: 16125294     BI number: CC1042     GOG: -------     Description: hypothetical protei   t t  g       tc c  c      g  a cg        cg cg        cg cg        gc ta        gc cg        cg ta       |  a ta       |  c c  |      |  g cg       |  g cg       g  a gt       g  t cg       t  g A  |      g  a A  |      g  g T  |      a  g A  |      a  g       ca C  |      g  g      g  g T  |       at        cg C  |       gc        gc G  |      g  g       cg Cg        gc        tg Gc        cg        gc Tg        gc        gc Cg        ta        gc Gc        tg        gc                         tttttcgTTG     ..................................................................................................................