                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-26.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-28.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGGCTGCGTTCAAGGCCATCGCCGACAAGGTCCGCGCCGCCCTGGCCTAAggtcttttt
gggtctttgatccaaccgatcttgcaaagcccccaggcgcgagcctgggggctttttgctgtccgaaacccttctccccttgcgggagaaggtggcccga
agggccggatgaggggttgaaaaacctctccggcagccgctcagagacccctcacccggtcttgctccgcaagaccaccctctcccgcaaggggagaggg
ttccagccagcccgaaaaccgcctagacggatgcccgtcATG

    CC1044 Gene: CC1044     GI: 16125296     BI number: CC1044     GOG: COG0016     Description: phenylalanyl-tRNA synthetase, alpha subuni   t t  t cg ta gt gc gc ta ta t  c t  c t  | cg ta gt gc At At Tg |  c |  a |  a C  a Cg Gc Gc        cg T  c      g  a C  c       cg C  c       gc C  a       gc G  |       at Cg        cg Cg        cg Gc        cg Cg        cg Gc        cg Cg        gc             tttttgctgtccgaaacccttctccccttgcgggagaaggtggcccgaagggccggatgaggggttgaaaaacctctccggcagccgctcagagacccctcacccggtcttgctccgcaagaccaccctctcccgcaaggggagagggttccagccagcccgaaaaccgcctagacggatgcccgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0016 Phenylalanyl-tRNA synthetase alpha subunit ... can be seen here     ..................................................................................................................