                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-19.50 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-21.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCgcatattcgcgagatatggtctcatccagtctgcccggaaaccgggagaaTGGAGCGGGCGAAGAGATTCGAACT
CTCGACATCCACCTTGGCAAGGTGGCGCTCTACCACTGAGCTACGCCCGCatcggcgaggccc
agaagagcgccccgcgacgaggaggcggcttatggcagagcgcttcgcggtttgcaagcgccctttgaggggttgcatcgcgggttttttccggggcttg
atccgggccggtttcaggcgggtttgaggcctggatttctcggggtggagcgccagcgTTG

    CC1055 Gene: CC1055     GI: 16125307     BI number: CC1055     GOG: COG0451     Description: conserved hypothetical protei   a g  c c  g g  a        t cg       t  c cg        cg |  a       gc cg        cg cg       g  g gc        at        tg cg        gt       t  a g  g       at        tg a  |       cg        cg gc        gc        cg at       g  |       cg at       t  |       gt g  a      a  |      c  | a  t       ta       g  | c  |       ta       a  | cg        cg        at cg       g  |       cg gc        gc        gc |  a       cg        ta |  g       gc       t  | g  a       gc       t  | a  g      a  |       gt gc        gc        gc cg        gt        cg gc        at        gc gt        gt        cg                         ggttttttccggggcttgatccgggccggtttcaggcgggtttgaggcctggatttctcggggtggagcgccagcgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here     ..................................................................................................................