                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGCGAGCCCACCAGCGGCTTTCTGTCGGCCTGGGCGGAGTTCGGGCTGGATACGGC
CAAGTCGCGCGGCAGCTTCAAGGCCGCCATCCCCAAGCCGAACCTGATGAAGTTCCCC
GGCTAGccgagccccaaaggaccagcgggccgtcacggcgctccaaattcgcgccgacacaatcgacaagggcgcatgcctgcccggggcttaggc
gccgggcgttttatcgcctgctcgacccttgcgcggccggcgccctcggcgcgtccttgagccctcgcaacgcaggggaagaacgaccATG

    CC1071 Gene: CC1071     GI: 16125323     BI number: CC1071     GOG: COG0079     Description: histidinol-phosphate aminotransferase, putativ                      ta                     t  g                      cg tg                  gc a  c        c       g  g c  c      c  c       gc gt       g  g       gc cg        tg        cg gc        cg        cg gc        cg        cg gc        gc        gc                         gttttatcgcctgctcgacccttgcgcggccggcgccctcggcgcgtccttgagccctcgcaacgcaggggaagaacgaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here     ..................................................................................................................