                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-19.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCTGGCCTTGAAGATCCGCGCCGTCGCCGAGGAGCATGGCGTGCCGGTCCTGGAAG
ACCCGCCGCTCGCCCGCGCCCTCTACGCCAGCGTCGAGATCGACGAGGAAATCCCGGT
TGAACACTTCGAAGCCGTCGCCAAGGTCATCAGCTTCATCCTCAACGGAAAGAAGCCC
CAGCCCCGGGCGCGTCCTCTCTAAgccacattctccagaaaactgacctagcctccagaaaaggctattctttctccaattg
cgggtgagtcgctggctcgccgtaagaaaggtacaacctcgccgATG

    CC1078 Gene: CC1078     GI: 16125330     BI number: CC1078     GOG: COG0642,COG0784     Description: cell cycle histidine kinase Cck   A C  A T  C CG CG TA |  A        c A  A      a  a CG       c  t TA       c  t TA        gc CG        At GC       |  c A  C      A  c C  C       Ta T  C       Cg A  A       Ta C  |      |  a TG       |  a GC       C  a GC       T  c |  C      C  t        g A  C       Cg       a  a A  G       Ta       c  a CG        Gc       c  a CG       |  c       ta GC       C  t       cg CG       G  a       cg T  |       Cg        gc GC        Gc        at CG        Gc        ta                         ttctttctccaattgcgggtgagtcgctggctcgccgtaagaaaggtacaacctcgccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG0784 FOG: CheY-like receiver ... can be seen here     ..................................................................................................................