                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-27.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-18.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGTCTCGAATGTCTTCAACGAAACCCCGCCGGCGGTCACGCTGGGCCAGGGCGAGT
ACGACACGGTGGGCGGCTCGGTGTTCGCCTCGCAGTACGACTATCTGGGTCGTCGGGT
GTTCCTGAACATCTCGACCCACTTCTAGtcttagcccaacgggctaacatggcggcggcgaccctgtggtcgccgccgt
ctttgtttcaaggaacctgttcgcgtgaacgccatcatccggggcaagcccgacaatctcgacgagatcggccagcgcttcgagcgtgcgcggctgaccc
aatcgGTG

    CC1100 Gene: CC1100     GI: 16125352     BI number: CC1100     GOG: -------     Description: hypothetical protei CT C  G TA TA GC TA         a GT       a  c GC        cg GT        cg C  |       cg T  |       gc GC        at        tg CG        ta       c  t TA        ta        cg GC       c  c       cg GC       t  a       at GC       G  |       gc TA        At        cg |  C       Tg        gc |  T       Cg        gc C  T      T  c       cg T  C       Tg        gc AT        Cg        gc TA       A  c       cg CG        Cg        gt At        Cg        gc                         tttgtttcaaggaacctgttcgcgtgaacgccatcatccggggcaagcccgacaatctcgacgagatcggccagcgcttcgagcgtgcgcggctgacccaatcgGTG     ..................................................................................................................