                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-22.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-17.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCGTCGGCGGCGCCTTCCTGCCGCTGGCCTTCGCCAAGATCGAAGAGATGACGGGT
TCCATGGCCATGGGCTTCGCAGCTCCGCTGCTCTGCTACGTCTACGTCCTGTGGTTCG
CCCTGGTCGCCAAGAAGGCCCCGACCCACGAGATCCAGGAAGGCGTGGCCGCCGGCCA
CTAGtctttcgcctgatactgccctgcaagcgcccccgggaggttcgtcctcccggggttctttttgtggcgagggcagggaaggccgggcctgggt
cgcctcgtttttgagcgcttcagatttccTTG

    CC1104 Gene: CC1104     GI: 16125356     BI number: CC1104     GOG: COG1301     Description: sodium:dicarboxylate symporter family protei   C G  C CG CG GC GC TA GC |  T       ag |  A      a  c CG        cg Gt        gc Gc       |  c At       |  c At       |  c        c Gt       t  c      t  g Gc        cg       t  t |  g       cg        gc |  c       cg        gc A  c      g  a       at C  t       tg        gc Cg        cg        gc Ta        at        gc At       t  |       cg |  a       at        cg Gc        gc        cg At        tg        cg                         ttctttttgtggcgagggcagggaaggccgggcctgggtcgcctcgtttttgagcgcttcagatttccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1301 Na+/H+-dicarboxylate symporters ... can be seen here     ..................................................................................................................