                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-10.94 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCCCGGCGATCACGCCGAAATCCCGGTCACCCAGTTCAAGTCGATCACCGTGCGGGA
AACCTATCCGGACGACTGGTTGACCCGCGGTCTTCACCGCAACCGGGCCGCCGCCTGA
GCCCCTGCTGCGTTTCGCCCTCGAGCCCCAGGTCAAGCCGTCTGACCCCGCGAAGCTT
TTCGCGGGGTTTTTCGTTTCGCCATCGGCGCCGACGATTGCACGGCCGTTAACCTTGT
GACACACAGAGCGCCGTTTTGCGGGGGCGGACATgacaataggcgacggggacgagcgcgccgagacgGTG

    CC1213 Gene: CC1213     GI: 16125463     BI number: CC1213     GOG: COG1846     Description: transcriptional regulator, MarR famil CC C  T        C CG       C  G GC       G  T AT       A  C |  G       AT GC        CG TG        TA |  T       GC |  T       GC |  T      A  C C  C      C  C CG       C  | GC       C  | |  C      C  | C  C      G  | C  T      A  | GC       G  | CG       C  |       CT |  A      T  |      G  T CG       C  |       AT GC       C  |       AT GC        CG        GC GC        GC        CG |  C       CG        GC |  A       TA        CG CG        TA        CG CG        TG        CG AT        GC        CG                         TTTTTCGTTTCGCCATCGGCGCCGACGATTGCACGGCCGTTAACCTTGTGACACACAGAGCGCCGTTTTGCGGGGGCGGACATgacaataggcgacggggacgagcgcgccgagacgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................