                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-28.30 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-19.55 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCATGCCGATGATCACGGCCACGGCCATGACGACCATGGACACGGCCATGACGATC
ACGGCCATGACGCCCATGGTCACGGCGGCCACGGACATGATGACCACGGCCATCACGA
AGACCATGGCCACGGTCACCACGACGCGCCCAAAAAGGAACTTGAGCACGCTCACCAC
TAGGTCGAGCGCAGGTTCAGAACCCAGAGCCCCGGATCCCAGGATCCGGGGCTCTTTC
TTTTCTGATCCGTCGTGAAAAGGCGTTTGCGCCTTGCATCGTCCGGCGCGCCACAGCA
TTGAGAGGCCATG

    CC1237 Gene: CC1237     GI: 16125486     BI number: CC1237     GOG: COG0861     Description: hypothetical protei CT A  A CG CG AT |  C CG TA CG GC CG A  | C  | G  | A  | GC TA TG CG AT AT GC G  A A  G       CA A  A      C  G A  A       CG A  C       TA A  C       AT C  C       GC C  A       GC C  G       CG G  A       CG CG        CG GC        CG C  C       GC A  C       AT GC        GC CG        AT             TTCTTTTCTGATCCGTCGTGAAAAGGCGTTTGCGCCTTGCATCGTCCGGCGCGCCACAGCATTGAGAGGCCATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here     ..................................................................................................................