                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.81 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGATGGCGATGAACTCCACCCAGTTCGCGCTGGGCGGCACCTCGATCCTGATCGTC
GTGACGGTGACCATGGACACCGTGGCGCAGATCCAGTCGCACCTGCTGGCCCACCAGT
ATGAGGGCCTGATCAAGAAGTCGAAGCTGCGCGGCGGACGCGGCCGCTAAggcgggcttcaat
tttattacaagcgtcggaagccggtttgtcacaaaaccggcttccgtttttattgccggggctctaggtctgctccgggagacagccgggcgcagactcg
gcgacgcgcgaaggggcttttATG

    CC1269 Gene: CC1269     GI: 16125518     BI number: CC1269     GOG: COG0563     Description: adenylate kinase, putativ   C G  G CG GC TG CG G  A A  C        a A  G      t  c GC       t  a CG       a  a TG       t  g GC       t  c       ca A  C      t  g      t  c A  G      t  t      g  a GC       a  c       ta AT       a  g       ta A  A       cg        ta C  A       ta        gc T  g       ta        gc A  g       cg        cg Gc        gc        cg Tg        gc        gc Cg       g  g       at Cg        cg        at Gc        gt        gc Gt        gt        gc Gt        At        cg                         tttttattgccggggctctaggtctgctccgggagacagccgggcgcagactcggcgacgcgcgaaggggcttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0563 Adenylate kinase and related kinases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_crescentus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:114 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-14.90 kcal/mol Antiterminator: Size=45 nt.     Delta G= -6.30 kcal/mol Anti-antiterminator:   Size=43 nt.     Delta G=-13.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GATGATGGCGATGAACTCCACCCAGTTCGCGCTGGGCGGCACCTCGATCCTGATCGTC GTGACGGTGACCATGGACACCGTGGCGCAGATCCAGTCGCACCTGCTGGCCCACCAGT ATGAGGGCCTGATCAAGAAGTCGAAGCTGCGCGGCGGACGCGGCCGCTAAggcgggcttcaat tttattacaagcgtcggaagccggtttgtcacaaaaccggcttccgtttttattgccggggctctaggtctgctccgggagacagccgggcgcagactcg gcgacgcgcgaaggggcttttATG     CC1269 Gene: CC1269     GI: 16125518     BI number: CC1269     GOG: COG0563     Description: adenylate kinase, putativ            AG CC       A  A C  A      C  A GC        TG GC        AT TA        GC CG        TG        GC GT       |  A      C  G |  A      C  A      A  G |  T       CG        GC |  G       GC        GC TA        GT        CG CG       G  |       GC CG       A  |       GT A  |      G  |      |  A CG       T  |      |  A GC       A  |      |  g C  |       TG        Cg T  |       GC        Gc GC       |  G       Cg AT       A  C      G  | C  |       CG        Tg CG        CG        Cg TA       A  C       Gc AT        CG        At GC        CG        At                         caattttattacaagcgtcggaagccggtttgtcacaaaaccggcttccgtttttattgccggggctctaggtctgctccgggagacagccgggcgcagactcggcgacgcgcgaaggggcttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0563 Adenylate kinase and related kinases ... can be seen here     ..................................................................................................................