                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cccttctaatccccttgtctagcccgcgcggtccctcagccgcgcgggcttcttttgtggagaacagtggggatgagcttaggcgcaggcgtagcgacgc
gatcggagcacgccgtcagaacctgatcgagaagcgtgtaatcgcagcaaggcgcgctaaagggctctgctagagcttgcttaccccgtttagaggggtc
cgtagaaacagggcaggctctaggtggtgtggactctaaggattcccaggatcgctgatgcgtgattcaaggctgtcttttggaggcggtcttgggtgtg
ATG

    CC1291 Gene: CC1291     GI: 16125540     BI number: CC1291     GOG: COG3293     Description: IS298, transposase Orf   a g  a a  a t  c g  a cg cg tg gc |  a       aa g  g      t  g g  g       cg gc        ta at       c  t       at gc        at       g  g at        gc       t  c ta        gc        cg t  g      |  c       gt t  g      |  a       cg gt       t  g       ta cg       g  g       at cg        ta        gt c  t       gt        gc cg        gc       a  a at        tg       c  a tg        gc        cg tg        gt        cg                         ctgtcttttggaggcggtcttgggtgtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3293 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................