                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-23.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-22.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCCCGTGCCGGTGGCCTATCACAGCTTCGGCGGCTGGAAGCGCTCGGGCTTTGGCGA
CCTCAATCAATACGGCATGGACGGCGTGCGGTTCTACACCCGCACCAAGACCGTGACC
CAGCGCTGGCCCAAGGGCGGGGCGGTGCTGGACCAGAGCTTTGTCATCCCCACCATGC
GGTGAcggttttcggggcctccccgaacgatagcgccgcctgcgagcgcgacctcaggcctcggacgaagcgcgtccggggccttttcttgtcgatg
ttcagcgcctggttaccggcgatggcgcgGTG

    CC1303 --- CC1304 --- CC1305 Gene: CC1303     GI: 16125552     BI number: CC1303     GOG: COG3212     Description: hypothetical protein Gene: CC1304     GI: 16125553     BI number: CC1304     GOG: COG0745     Description: DNA-binding response regulator Gene: CC1305     GI: 16125554     BI number: CC1305     GOG: COG0642     Description: sensor histidine kinas   c c  t       ct gc       c  g gc        gc gc        cg gc       |  a cg        cg ta        gc ta        cg |  c       gc tg       |  g        g ta       |  a      a  c gt       a  c      a  g g  a      t  c       gc c  g       at        cg A  |       gc        at Gc       |  a       gc Tg       |  g       gc Gc       |  g       cg Gc       c  c       tg Cg       a  c       cg Gc        at        cg T  c       gc        gc At        cg        gc Cg        cg        at                         tttcttgtcgatgttcagcgcctggttaccggcgatggcgcgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3212 Predicted membrane protein ... can be seen here [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................