                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-21.20 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-21.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCAGCCTGAGCTCGGCCCTGCTGATGCCCAAGGACGGTCGGACGCTGGAAGACGTCG
TACGCGAGCTGCTGCGCCCGCTGCTCAAGGAGTGGCTGGACCAGAACCTGCCGCGCAT
CGTCGAGACCAAGGTTGAGGAAGAAGTGCAGCGTATCTCTCGGGGACGCGGCGCCTAA
aacttccgaaccgtcggaaaatcgaggcggtcgctgcggcgaccgcctttttcgttgcgcaatccttcagaaaacctcggcccgccggtttcccgggcgg
gccgcagatggcatatccgctccgccATG

   ق Gene: CC1320     GI: 16125569     BI number: CC1320     GOG: COG0525     Description: valyl-tRNA synthetas TC C  G TG CG TG A  |       cc TA       a  g GC        at CG        gc GC        cg A  G       cg CG        ta GC        ta TG       c  a GC       a  a |  C      a  t |  T      A  c |  A      A  g |  A       Ta A  a       Cg A  a       Cg Gc        Gc        gc At       |  g      t  g At       |  g       cg Gc       |  t       gc Gc       |  c       cg A  g       Cg        ta G  |       Gc        gc Ta        Gt        gc Ta        Cg        cg Gc        Gc        gc Gc        Cg        gc                         tttttcgttgcgcaatccttcagaaaacctcggcccgccggtttcccgggcgggccgcagatggcatatccgctccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0525 Valyl-tRNA synthetase ... can be seen here     ..................................................................................................................