Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:9 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-23.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGAACTGCAGGCGCGCCTGTTGGCCTATGTCGGCTACACCCCGGTGCAGAACGTGG
CCGGCGCCCCGGCCATGAGCGTGCCGCTGCACTGGACGGCCGATGGCCTGCCGGTCGG
CGTACAGTTCGCCGGTCGCGCAGGCGATGAGGCGACCCTGTTCGCCCTAGCCTATCAG
CTGGAGGCCGCCGCGCCCTGGGCGCACCGCAAGCCGCCGGTGAGCGCTTAAgccgggtcaga
gatcatctgacggacacaaagaaggagcgcccagcgatagccgggcgctccttttgtctttcccGTG

    CC1322


Gene: CC1322     GI: 16125571     BI number: CC1322     GOG: -------     Description: hypothetical protei


            t
          a  c
          g  a
           at
           gc
           at
           cg
  G       |  a
A  C      |  c
A  C      |  g
 CG       |  g
 GC       |  a
|  C      |  c
 CG       |  a
 CG       |  c
 AT       |  a
|  G      |  a
|  A      |  a
 CG       |  g
 GC       |  a       at
 CG       |  a      g  a
 GC       |  g       cg
 GT       |  g       gc
 GT       |  a      a  c
 TA       |  g       cg
C  A      |  c       cg
C  |       tg        cg
 Cg        gc        gc
 Gc        gc        cg
C  |       gc        gc
 Gc       c  a       at
 Cg        cg        gc
 Cg        gc        gc
                        ttttgtctttcccGTG


    ..................................................................................................................