                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGCCGATCCAGGTGAACCTGCCCAAGTACGGCGAGCCGGCGCGTCTCTACTGCCCG
GCCGGCGTCTATGAAGTGCTCTACAATGAGCAGGGCGGTGATCCGCGCTTCCAGATCA
ATGCGCAGAACTGCGTCCACTGCAAAACCTGCGACATCAAGGACCCGTCGCAGAATAT
CGTCTGGACCACGCCGGAAGGCGGTGGTGGCCCGAACTATCCGAACATGTGAcgaagcagc
ctcccgcccctcaggtcgggaggctttttcttgcggaccgcctcgaaacctccgagggtggcggcATG

    CC1335 --- CC1336 --- CC1337 Gene: CC1335     GI: 16125584     BI number: CC1335     GOG: COG0457     Description: TPR domain protein Gene: CC1336     GI: 16125585     BI number: CC1336     GOG: COG1947     Description: kinase, GHMP family, group 2 Gene: CC1337     GI: 16125586     BI number: CC1337     GOG: COG0652     Description: peptidyl-prolyl cis-trans isomerase             G           C  A           C  A           T  C           A  A           T  T            CG            AT GA       |  G G  A      A  A CG        Gc CG        Cg         t GC       |  a      c  c |  G      |  a      c  a CG       |  g       cg AT       |  c       cg CG       C  a      |  t CG        Cg        gc AT        Gc        cg |  G       Gc        cg |  G      |  t       cg GC       T  c       ta GC        Gc        cg T  C       Gc        cg CG        Tg        gc TA        Gc        at                         ttttcttgcggaccgcctcgaaacctccgagggtggcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here [O] COG0652 Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family ... can be seen here     ..................................................................................................................