                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-25.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGTCGTCGTGACCGTCGAAGGCTCGGGCCTGTCGGGCCAGGCCGGCGCGATCCGCCA
CGGCCTGTCGAAGGCTCTGACCTATTACGAACCCGGCCTGCGCCCGGTCCTGAAGCCG
CACGGCTTCCTGACCCGCGACAGCCGCGTCGTCGAGCGTAAGAAGTACGGTAAGGCCA
AGGCCCGCCGCAGCTTCCAGTTCTCGAAGCGCTAAtcgcgacgattacgtgtttgggaaggggcgcttcggttc
agccgaagcgccctttttcttgtcctgtctcttgttcggattggagtccgccATG

    CC1378 Gene: CC1378     GI: 16125627     BI number: CC1378     GOG: COG0002     Description: N-acetyl-gamma-glutamyl-phosphate reductas ta t  c a  g gt cg |  t at gt         c cg       t  a g  g      t  g cg        gc ta        gc |  a       cg A  g       ta A  g       ta Tg        cg Cg        gc Gc        cg Cg        gc Gc        gc At        gc At        gt Gc        at             tttcttgtcctgtctcttgttcggattggagtccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0002 Acetylglutamate semialdehyde dehydrogenase ... can be seen here     ..................................................................................................................