                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-23.60 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-18.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCCGACGTCAAGAAGGTCTATTTCAGCACCGACGCCAAGATCAACGGCGGCGCGCT
GAAGGCCAAGGTCGACCTCGATCCGGTCGTCGCTTCGATCGGCCTGTCGCGCAAATTC
TAAccccccggcggacgtccccggtcgtccgtcctctggctccccgtcgttcgccggcggggagcttttctttgtgcggtcaggaccagacgtgacgg
agatcgtgacggcgattgatcggcgtcaaggtcgcgcggccgggaaccgcgcatgaaggggatatgaagctggggagcgccacctcATG

    CC1410 Gene: CC1410     GI: 16125659     BI number: CC1410     GOG: COG0664     Description: transcriptional activator, putativ cc c  g c  g t  t gc cg at gc gc cg gt gc c  c c  t c  c c  | c  | c  | A  | A  | T  | C  | T  | T  | A  | A  | A  | C  | G  | C  |        c Gt       t  g Cg       t  c Tg        gc Gc        cg T  t       tg C  c       gc C  c       cg Gc        cg Gc        cg Cg        cg T  |       ta At        cg Gc        gc Cg        gt             tttctttgtgcggtcaggaccagacgtgacggagatcgtgacggcgattgatcggcgtcaaggtcgcgcggccgggaaccgcgcatgaaggggatatgaagctggggagcgccacctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0664 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases ... can be seen here     ..................................................................................................................