Gene putatively regulated by attenuation in C_crescentus
Characteristics of the secondary structures
Terminator: Distance to gene:187 nt. Distance to run of Ts=0 nt. Size=33 nt. Delta G=-12.90 kcal/mol
Antiterminator: Size=43 nt. Delta G=-12.10 kcal/mol
Anti-antiterminator: Size=23 nt. Delta G= -5.60 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
agtccggttcggtcgaggtggggtctagggcctcaagcttcgtagggtagggtgatggagagtctcgccgccgctggccaggcacacctgtgggtgaagt
tgctttggcttttgtctgtcgcgggtgcgacattcctggtcgtgcgagcgatcaccgcgcatgggcgtctcggtgagattcagaacgcactgcggcgcgc
gattgatcagcgcgacgaggcccttgtcgcgctcaagcacagtcgccagaccatcgccgagctcgaacaacgactcgccctccaaggcgacagcatccgg
TTG
CC1417
Gene: CC1417 GI: 16125666 BI number: CC1417 GOG: ------- Description: hypothetical protei
c
g c
c g
t c
c c gt
tg t g
gc cg
at cg
g g at
a g cg
gc | a
T gc | a
T G ta | g
g t | g | t
g a a g at
cg gc cg
cg ta gc
tg gc | t
at | a gt
cg gc at
g a gc cg
at at cg
cg tg gc
ttttgtctgtcgcgggtgcgacattcctggtcgtgcgagcgatcaccgcgcatgggcgtctcggtgagattcagaacgcactgcggcgcgcgattgatcagcgcgacgaggcccttgtcgcgctcaagcacagtcgccagaccatcgccgagctcgaacaacgactcgccctccaaggcgacagcatccggTTG
..................................................................................................................