                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.72 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-19.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCATGGCGTCGGCGATAACGCTGGGGTGGATGCCCGAAGCGCCGACATCGGCCTGG
GCCAGGACGCTTGCCGAGGATTCCAGGGCGCTTTTACGGGACATggcggaggccttagactttgctg
ttaaccatgttttgaggcgctatgcttaactgagtcctaagctgcgtcttacggtcgcaagcgcggtcgttcggggtggcaaggtggcgttaacacgtgt
tcgcctagcttgccgtccaagccgccgccctggcggatctgggctcgcagcgtcaacgaaagggagcggcatcaaGTG

    CC1458 --- CC1459 Gene: CC1458     GI: 16125707     BI number: CC1458     GOG: COG5443     Description: flbT protein Gene: CC1459     GI: 16125708     BI number: CC1459     GOG: COG5442     Description: flaF protei TG C  G CG GC GC C  A T  | A  | C  |        C A  |      G  T G  |      C  T CG       G  T CG       G  T |  A      G  A GC       A  C       tt CG        CG       c  a GC        CG       c  g AT        TG       g  a AT        TA        gc |  G      |  C       at |  C      A  A       gt GC       G  T       gt CG       G  g       cg |  A      A  g       gc CG        Gc        gt CG        Cg        Tg G  A       Cg        At T  T      G  |      C  t AT        Ta       A  a GC        Tg       G  a GC        Cg        Gc TA        Gc        Gc                         atgttttgaggcgctatgcttaactgagtcctaagctgcgtcttacggtcgcaagcgcggtcgttcggggtggcaaggtggcgttaacacgtgttcgcctagcttgccgtccaagccgccgccctggcggatctgggctcgcagcgtcaacgaaagggagcggcatcaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG5443 Flagellar biosynthesis regulator FlbT ... can be seen here [N] COG5442 Flagellar biosynthesis regulator FlaF ... can be seen here     ..................................................................................................................