                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-30.00 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-22.89 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-23.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGATCAATCGCATGATCATGCAGGGGCTGGCTGGCCGCGCCGACGCGGCCTGAttctgcct
ttcgggcaaggctgtatgtcttgcccagtcattctggaaaaagctgccgcccggcgaatgttgcattcgccgggcggttttgtttttggccgatagatcc
caaaaagatcagcaaaaacaaatagatatttttcctcgattttggcgcggggctggcccgccgcttgcgatggttcgcgcgggcaaaacgccagcccggc
aatacgccggaaaaatcccaccaaaacggtaggtatcaaATG

    CC1460 Gene: CC1460     GI: 16125709     BI number: CC1460     GOG: COG1344     Description: flagellin Flj             t           g  a           t  t            cg            gt            gc            at CG        at C  A       cg GC        gc CG        gc GC        gc CG       |  a CG       |  g GC       c  t GC       t  c |  T      t  a |  G      t  t T  A      c  t        t C  t      c  c      t  g Gt       g  t       gc Gc        tg        ta T  t       cg        at Cg        ta        at Gc        ta        gc Gc       A  a       cg Gt       G  a       gc Gt        Ta        gc |  t       Cg        cg |  c      |  c       cg |  g      |  t       cg A  g       Cg        gc Cg        Gc        cg Gc        Gc        cg Ta        Cg        gt                         tttgtttttggccgatagatcccaaaaagatcagcaaaaacaaatagatatttttcctcgattttggcgcggggctggcccgccgcttgcgatggttcgcgcgggcaaaacgccagcccggcaatacgccggaaaaatcccaccaaaacggtaggtatcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1344 Flagellin and related hook-associated proteins ... can be seen here     ..................................................................................................................