                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:139 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-18.40 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCCAGCCGCTCGGTCGATCCGCTGAACCATCTGCAGCTGGAGCTTCTGTCGCGCCG
CCGGGCGGGGGACATCGACGAAGAGCTGCGTCTGGCGATTCAGCTCACCGTCGCCGGG
ATCGCGGCGGGCCTGCGCAACACGGGCTGAgggagcggtgtttcttcaggtctcggaaggctcgtgaatccaaggggt
taggactggaaaattctcgcgtaacggtgcttgcgctcttcttcggtttctgattatctgccgatgacaccggtggcaaagacggctctgctgctctcgg
taaccgGTG

    CC1494 --- CC1495 --- CC1496 Gene: CC1494     GI: 16125741     BI number: CC1494     GOG: -------     Description: hypothetical protein Gene: CC1495     GI: 16125742     BI number: CC1495     GOG: COG0800     Description: 4-hydroxy-2-oxoglutarate aldolase/2-deydro-3-deoxyphosphogluconate aldolase Gene: CC1496     GI: 16125743     BI number: CC1496     GOG: COG0524     Description: carbohydrate kinase, pfkB famil             G           G  A           G  T           C  C            CG            GC            CG            TG            GC            CG            CG         A           A  |      C  A           C  |      G  C           T  |      C  A           C  |       GC           G  |       TG           A  |       CG CT       C  |       CG G  C      T  |       GC A  A      T  |       GT C  C      A  |      |  G T  C      G  |      |  A TG        CG       G  g AT        GC       C  g GC        GC       G  g CG       T  T      G  a GC       C  |       Cg GC        TG        Gc TG        GC        Cg CG        CG        Tg TG        GC        At                         gtttcttcaggtctcggaaggctcgtgaatccaaggggttaggactggaaaattctcgcgtaacggtgcttgcgctcttcttcggtttctgattatctgccgatgacaccggtggcaaagacggctctgctgctctcggtaaccgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0800 2-keto-3-deoxy-6-phosphogluconate aldolase ... can be seen here [G] COG0524 Sugar kinases, ribokinase family ... can be seen here     ..................................................................................................................