                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-24.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.32 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCCCCCAGGCCGCCGTCGAGTACGGCGCGGCTCACGGCGCCCTGGCCATGACCACC
CCGGGCGACACCTCGATGGTGCGCAAGGAAGAGGTCGAGGCCGTGATGAAGGGCAAGG
GCGCGCGGGTCATCCGCTAAagctctcgttctttgaagaacaaggagaagtcctcggtcgcaaggccggggactttttctttgat
gtagggcgggttgtagatgtcggcctcctcgcgctccttctccgcgaggagttcggcgaaccgcgtgaagcgctcctgaagcttgcgggtcagccaggcT
TG

    CC1497 Gene: CC1497     GI: 16125744     BI number: CC1497     GOG: -------     Description: hypothetical protei   C T  A       tg G  T      t  a GC        ta GC        cg CG        ta GC        ta |  T       gc |  A      |  a C  A      c  a       ca G  a       tg       g  a Cg        cg        cg Gc        ta        tg Gt        cg        gc Gc       |  a       gc At       g  a       cg A  c      a  g       tg Cg       A  t       cg Gt       A  c       cg Gt       T  c       ta Gc       C  t       gc At        Gc        at At        Cg        at Gt        Cg        gt                         ttctttgatgtagggcgggttgtagatgtcggcctcctcgcgctccttctccgcgaggagttcggcgaaccgcgtgaagcgctcctgaagcttgcgggtcagccaggcTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_crescentus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:150 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-11.40 kcal/mol Antiterminator: Size=44 nt.     Delta G= -9.40 kcal/mol Anti-antiterminator:   Size=57 nt.     Delta G=-29.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGGCCCCCAGGCCGCCGTCGAGTACGGCGCGGCTCACGGCGCCCTGGCCATGACCACC CCGGGCGACACCTCGATGGTGCGCAAGGAAGAGGTCGAGGCCGTGATGAAGGGCAAGG GCGCGCGGGTCATCCGCTAAagctctcgttctttgaagaacaaggagaagtcctcggtcgcaaggccggggactttttctttgat gtagggcgggttgtagatgtcggcctcctcgcgctccttctccgcgaggagttcggcgaaccgcgtgaagcgctcctgaagcttgcgggtcagccaggcT TG     CC1497 Gene: CC1497     GI: 16125744     BI number: CC1497     GOG: -------     Description: hypothetical protei   G C  A T  T CG         T CG       A  G AT       G  A CG       T  A A  |      G  G GC        CG CG        CG GC        GC G  A      G  A G  A      A  A CG       G  G CG        CG         C |  A       TG       T  A C  A       GC       G  T C  G      G  |       GC A  A      A  |       GC CG       G  |       CG CG       A  |       GC AT       A  |      |  T GC       G  |      |  A TG       G  |      C  A A  A      A  |      G  a CG       A  |       Cg CG        CG        Gc GC        GC        Gt GC        CG        Gc TG        GC        At                         cgttctttgaagaacaaggagaagtcctcggtcgcaaggccggggactttttctttgatgtagggcgggttgtagatgtcggcctcctcgcgctccttctccgcgaggagttcggcgaaccgcgtgaagcgctcctgaagcttgcgggtcagccaggcTTG     ..................................................................................................................